Table 1 Primer sequences
From: Expression of VPAC1 in a murine model of allergic asthma
Gene | Primer forward | Primer reverse | Product size |
|---|---|---|---|
PBGD | cacgatcctgaaactctgct | agatggtccagaagatgaccc | 224 |
PAC1 | ttcactactgcgtggtgtccaact | atatcccagcatcccgcatcatca | 228 |
From: Expression of VPAC1 in a murine model of allergic asthma
Gene | Primer forward | Primer reverse | Product size |
|---|---|---|---|
PBGD | cacgatcctgaaactctgct | agatggtccagaagatgaccc | 224 |
PAC1 | ttcactactgcgtggtgtccaact | atatcccagcatcccgcatcatca | 228 |
Journal of Occupational Medicine and Toxicology