Skip to main content

Table 1 RT primers of 5 significant miRNAs

From: Serum levels of miR-21-5p and miR-339-5p associate with occupational trichloroethylene hypersensitivity syndrome

miRNAs RT primers 5′-3′
hsa-miR-93-5p a GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCTACCTG
hsa-miR-34a-5p GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACAACCA
hsa-miR-193b-3p GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAGCGGGA
hsa-miR-21-5p GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCAACA
hsa-miR-10a-5p GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCACAAA
hsa-miR-339-5p GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCGTGAGCTC
  1. aInternal reference gene