Skip to main content

Table 2 Primer sequences of 5 significant miRNAs

From: Serum levels of miR-21-5p and miR-339-5p associate with occupational trichloroethylene hypersensitivity syndrome

miRNAs Primer sequence 5′-3′
hsa-miR-93-5p a F: GGCAAAGTGCTGTTCGTG
R: CAGTGCGTGTCGTGGAGT
hsa-miR-34a-5p F:GGGGTGGCAGTGTCTTAGC
R:CAGTGCGTGTCGTGGAGT
hsa-miR-193b-3p F:CGGAACTGGCCCTCAAAG
R:CAGTGCGTGTCGTGGAGT
hsa-miR-21-5p F:GGGGGGTAGCTTATCAGACTG
R:CAGTGCGTGTCGTGGAGT
hsa-miR-10a-5p F:GGGTACCCTGTAGATCCGA
R:CAGTGCGTGTCGTGGAGT
hsa-miR-339-5p F:GGGTCCCTGTCCTCCA
R:TGCGTGTCGTGGAGTC
  1. aInternal reference gene